【病毒外文文獻(xiàn)】2006 Important Role for the Transmembrane Domain of Severe Acute Respiratory Syndrome Coronavirus Spike Protein during E

《【病毒外文文獻(xiàn)】2006 Important Role for the Transmembrane Domain of Severe Acute Respiratory Syndrome Coronavirus Spike Protein during E》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2006 Important Role for the Transmembrane Domain of Severe Acute Respiratory Syndrome Coronavirus Spike Protein during E（9頁(yè)珍藏版）》請(qǐng)?jiān)谘b配圖網(wǎng)上搜索。

JOURNAL OF VIROLOGY Feb 2006 p 1302 1310 Vol 80 No 3 0022 538X 06 08 00H110010 doi 10 1128 JVI 80 3 1302 1310 2006 Copyright 2006 American Society for Microbiology All Rights Reserved Important Role for the Transmembrane Domain of Severe Acute Respiratory Syndrome Coronavirus Spike Protein during Entry Rene Broer 1 Bertrand Boson 2 Willy Spaan 1 Franc ois Lo c Cosset 2 and Jeroen Corver 1 Department of Medical Microbiology Center of Infectious Diseases Leiden University Medical Center 2300 RC Leiden The Netherlands 1 and Laboratoire de Vectorologie Re trovirale et The rapie Ge nique INSERM U412 IFR128 BioSciences Lyon Gerland Ecole Normale Supe rieure de Lyon 46 alle e d Italie 69364 Lyon Cedex 07 France 2 Received 3 June 2005 Accepted 11 November 2005 The spike protein S of severe acute respiratory syndrome coronavirus SARS CoV is responsible for receptor binding and membrane fusion It contains a highly conserved transmembrane domain that consists of three parts an N terminal tryptophan rich domain a central domain and a cysteine rich C terminal domain The cytoplasmic tail of S has previously been shown to be required for assembly Here the roles of the transmembrane and cytoplasmic domains of S in the infectivity and membrane fusion activity of SARS CoV have been studied SARS CoV S pseudotyped retrovirus SARSpp was used to measure S mediated infectivity In addition the cell cell fusion activity of S was monitored by a Renilla luciferase based cell cell fusion assay SVSV Cyt an S chimera with a cytoplasmic tail derived from vesicular stomatitis virus G protein VSV G and SMHV TMDCyt an S chimera with the cytoplasmic and transmembrane domains of mouse hepatitis virus displayed wild type like activity in both assays SVSV TMDCyt a chimera with the cytoplasmic and transmembrane domains of VSV G was impaired in the SARSpp and cell cell fusion assays showing 3 to 25 activity compared to the wild type depending on the assay and the cells used Examination of the oligomeric state of the chimeric S proteins in SARSpp revealed that SVSV TMDCyt trimers were less stable than wild type S trimers possibly explaining the lowered fusogenicity and infectivity In the winter of 2002 to 2003 a new type of pneumonia severe acute respiratory syndrome SARS emerged in Guangdong province China The etiological agent causing this disease was found to be an unknown coronavirus which was named SARS coronavirus SARS CoV 10 18 23 30 Among the structural proteins of SARS CoV the spike S protein is the largest comprising 1 255 amino acids Research on SARS and other coronavirus S proteins has shown that S is involved in receptor binding and membrane fusion and is a major determinant of the immune response and pathogenesis 12 The spike protein is a type I membrane protein and is anchored in the membrane of the virion Peplomers oligomers of two or three spike proteins 9 form the distinctive co rona on the virus The main receptor for SARS CoV has been identified as angiotensin converting enzyme 2 ACE 2 20 ACE 2 is ex pressed in several tissues among which are epithelia in the lung and small intestine 15 It has been shown that amino acids 318 to 510 of SARS CoV S are sufficient to bind to ACE 2 1 44 45 L SIGN has been shown to function as an alternative receptor albeit with a significantly lower affinity than ACE 2 17 Another lectin DC SIGN has been impli cated in enhancement of infection by dendritic cell transfer a process earlier described for other viruses such as human im munodeficiency virus HIV and hepatitis C virus HCV 16 24 49 In most but not all coronaviruses S is cleaved during viral maturation by a host cell protease to create the subunits S1 and S2 11 40 It is unclear at this moment whether this type of cleavage of the SARS CoV spike protein occurs Recently however evidence has emerged showing that SARS S is cleaved during entry of the virus rather than during maturation Low pH dependent endosome resident cysteine proteases i e cathepsin L have been shown to be involved in SARS CoV entry by cleav age of S Specific inhibitors of cathepsin L block entry of SARS pseudotypes and also infection with SARS CoV 36 Coronavirus S proteins have been proposed to be class I viral membrane fusion proteins 4 Class I proteins contain a fusion peptide at or close to the N terminus of the integral membrane fragment of the spike protein consisting of about 20 hydro phobic amino acids that enters the target membrane to initiate fusion Furthermore the class I proteins contain two 4 3 hy drophobic heptad repeats HR 6 8 and often an aromatic rich domain within or close to the transmembrane domain TMD which anchors the protein in the viral membrane The S2 subunit of the spike protein contains two heptad repeats HR1 and HR2 with a high affinity for each other HR1 is located downstream of the internal putative fusion peptide and HR2 is located just upstream of the transmem brane domain see Fig 1a Upon onset of fusion a confor mational change takes place in the spike oligomer and the HRs form a so called six helix bundle three H9251 helices formed by HR1 and three antiparallel HR2 H9251 helices thus bringing the fusion peptide and the TMD of the spike protein in close proximity 4 This structure represents the postfusion con Corresponding author Mailing address Leiden University Medi cal Center Department of Medical Microbiology E4 P P O Box 9600 2300 RC Leiden The Netherlands Phone 31 715263649 Fax 31 715266761 E mail j corver lumc nl R B and B B contributed equally to this work 1302 on April 6 2015 by ST ANDREWS UNIV http jvi asm org Downloaded from formation The affinity of the two HRs for each other stabilizes this conformation and ensures fusion of the virus and target membrane The trigger for this conformational change in the coronavirus spike protein is usually the interaction with the receptor 51 However initiation of the membrane fusion process of SARS CoV by low pH cannot be ruled out at this time 16 49 It is not known what conformational changes are occurring within the S protein to acquire the six helix bundle Since the native structure of the whole S protein has not been solved yet in contrast to the HR1 HR2 complex 42 47 48 it remains unclear what other domains of S2 are involved in fusion It has however become clear that in contrast with other class I viral membrane fusion proteins the N terminus of coronavirus S2 is not the fusion peptide since it lacks the characteristic features described for fusion peptides Rather in coronaviruses the fusion peptide is an internal hydrophobic amino acid stretch Putative coronavirus fusion peptides have been proposed 4 based on hydrophobicity plots and on peptide studies 32 but no conclusive evidence has been presented to date which points out the fusion peptide of coronaviruses Besides the HRs and the fusion peptide another character istic feature of the coronavirus S2 subunit is the length of its TMD Although the exact borders of the TMD have never been experimentally identified we assume that the TMD is located between the two charged lysine residues at amino acid positions 1194 and 1227 see Fig 1b This means that the TMD would comprise 34 amino acids which is longer than necessary to cross the membrane Within the TMD there are three conserved distinctive domains an N terminal tryptophan Trp rich region a hydrophobic central region and a cysteine rich C terminal domain In this study we set out to investigate the role of the unusu ally long TMD and the cytoplasmic tail of the spike protein in the membrane fusion activity and infectivity of SARS CoV MATERIALS AND METHODS Cells and viruses 293T cells were obtained from the ATCC and cultured in Dulbecco s modified Eagle medium DMEM with 10 fetal calf serum FCS VeroE6R cells were a kind gift of A D M E Osterhaus and they were cultured in DMEM with 10 FCS SARS CoV strain Frankfurt was a kind gift of H F Rabenau and H W Doerr Construction of SARS spike expression vectors The SARS spike gene of the Frankfurt 1 isolate was cloned by reverse transcriptase PCR RT PCR on RNA isolated from infected Vero cells as previously described 38 and cloned into the gateway vector pDEST 14 Invitrogen The gateway construct was completely sequenced and used as a basis for further cloning The T7 driven SARS spike expression vector pLSS3 was obtained by cloning the 5H11032 end of the SARS spike gene into vector pL1A 38 after RT PCR on isolated viral RNA using primers SAV31 and SAV033 located downstream of the unique NcoI site resulting into construct pLSS1 Sequences of primers used in this study are given in Table 1 The 3H11032 end of the SARS spike gene was cloned into vector pLSS1 after RT PCR with primers SAV032 and SAV027 located upstream of the unique EcoRV site resulting in vector pLSS2 The internal NcoI EcoRV SARS spike fragment from the gateway clone was cloned into vector pLSS2 leading to the full length spike expression construct pLSS3 Construct phCMV SWT was made by first modifying vector phCMV 27 by insertion of a BamHI KpnI XhoI linker SAV039 SAV040 leading to vector phCMV BKX The SARS spike gene was inserted into vector phCMV BKX in a 3 point ligation containing the BamHI BlnI and BlnI XhoI fragments from pLSS33 leading to vector phCMV SWT Once cloned the sequences of the 5H11032 and 3H11032 borders of the S encoding region were verified Construction of other vectors A cDNA clone containing ACE 2 cDNA was obtained from the German Resource Center for Genome Research clone IRAKp961I1334Q2 PCR on this plasmid was carried out using primers SAV054 and SAV055 The PCR fragment was cloned into pcDNA3 using the introduced XbaI and XhoI sites Sequencing of this clone using primers SAV054 SAV062 showed two point mutations They were restored back to wild type by QuikChange mutagenesis Stratagene using primers SAV068 SAV071 yielding FIG 1 Schematic presentation of the SARS CoV spike protein a The spike protein has an N terminal signal sequence SS a putative fusion peptide FP two heptad repeats HR a transmembrane domain TMD and a C terminal cytoplasmic domain Cyt The arbitrary border between S1 and S2 is indicated The ACE 2 binding region is specified as part of S1 b Amino acid sequence of the transmembrane domain of SARS CoV S top VSV G middle and MHV S bottom The Trp rich domain is depicted in a dark gray box and the Cys rich domain is light gray boxed c Schematic representation of the wt S SWT and S chimeras that are used in the experiments TABLE 1 Oligonucleotides used in this study Name Sequence SAV027 CATCAACTGCATTGGGC SAV031 ATATGAATTCGGATCCGCGGACGCGTA CCATGTTTATTTTCTTATTATTTCTTACTC SAV032 ATATCTCGAGCATGCGGGCCCGGATCCCGG GTACCTTATGTGTAATGTAATTTGACACCC SAV033 CTGAAACATCAAGCGAAAAGGC SAV039 GATCCGGTACCCTCGAGC SAV040 GATCGCTCGAGGGTACCG SAV054 AATTGCATGCTCGAGAGGGGACGA TGTCAAGCTCTTCCTG SAV055 AATTTCTAGAGGGCCCCTAAAAGG AGGTCTGAACATCATC SAV058 CTACAGTACTGGAAAAGTTTG SAV059 CAGTCCAATTGGATGCCTCC SAV060 GGACGACTTCCTGACAGCTC SAV061 CATACTGTGACCCCGCATCTC SAV062 GATGGAGTACCGACTGGAGTCC SAV065 GCATGACTAGTTGTTGCAGTTGCCTCC GAGTTGGTATCCATCTTTGC SAV066 GGGGTACCGAGTTACTTTCCAAGTCGG SAV067 AGTGTGCTAAATGATATCCTTTCGCG SAV068 GATGCACAGAGAATATTCAAG SAV069 CTTGAATATTCTCTGTGCATC SAV070 GCAGTCTGCCATCCCACAGC SAV071 GCTGTGGGATGGCAGACTGC SAV072 GGGAAAATATGAGCAATATATTAAAAGCTC TATTGCCTCTTTTTTCTTTATCATAGGG VOL 80 2006 SARS CoV S TRANSMEMBRANE DOMAIN INVOLVED IN FUSION 1303 on April 6 2015 by ST ANDREWS UNIV http jvi asm org Downloaded from pcDNA3 FLACE2 Subsequently the T7 promoter of the plasmid was deleted by SpeI digestion and self ligation pcDNA3 FLACE2H9004SpeI Then a cassette con taining a T7 promoter the Renilla luciferase gene the 3H11032 nontranslated region NTR of hepatitis C virus and a T7 termination signal the fragment was originally obtained from plasmid pHCVwt RLuc 3H11032UTR C B E M Reusken personal communication was cloned into this plasmid using the NotI and XhoI sites yielding plasmid pFLACE2 T7rLuc Plasmid pBP9 CMVT7 contains a cytomegalovirus CMV promoter driven T7 polymerase gene 7 followed by a simian virus 40 polyadenylation signal and was cloned using conventional cloning procedures Recombinant SARS spike expression VeroE6R cells were seeded into 35 mm wells 0 5 H11003 10 6 cells well and 16 h later transfected with 2 H9262g of DNA per 35 mm plate using Lipofectamine Invitrogen according to the manufacturer s protocol A typical labeling experiment was performed as follows Cells were starved 18 h posttransfection hpt for 30 min in RPMI 1640 without Met and Cys and were subsequently labeled metabolically with RPMI 1640 without Met and Cys plus 35 S Cys and 35 S Met ICN Biomedicals Inc After a 2 h labeling the medium was removed and replaced by chase medium DMEM plus 10 FCS and extra 2 5 fold Met and Cys Cells were lysed in RIPA buffer 3 after a chase period of 0 3 5 or 7 h The lysates were centrifuged for 5 min at 13 000 rpm to remove nuclei and cell debris Immunoprecipitations were performed on the supernatants as previously described 3 by using a polyclonal rabbit antibody against SARS CoV kindly provided by M Niedrig 16 Protein samples were EndoH digested according to the manufacturer s protocol New England Bio labs and analyzed on 8 polyacrylamide gels Biotinylation of spike proteins 293T cells were transfected with a spike encoding plasmid At 24 h posttransfection the cells were trypsinized and pel leted After three washes with phosphate buffered saline PBS cells were incu bated in PBS plus 0 5 mg ml Sulfo NHS LC biotin Pierce for 20 min at 4 C Subsequently the cells were washed with PBS plus 0 1 M glycine and incubated in the same buffer for 15 min at 4 C Cells were then washed twice with PBS and finally lysed in TENT buffer 50 mM Tris pH 7 5 5 mM EDTA 150 mM NaCl 0 5 Triton X 100 Construction of spike chimeras Chimeras SVSV Cyt and SVSV TMDCyt were made by fusion PCR Fusion primer SAV065 3H11032 primer SAV066 and 5H11032 primer SAV067 were used for SVSV Cyt Fusion primer SAV072 3H11032 primer SAV066 and 5H11032 primer SAV067 were used for SVSV TMDCyt PCR products were digested with EcoRV and KpnI and inserted into vector phCMV S WT Chimera SMHV TMDCyt was made by replacing the StyI BamHI fragment from vector pSP72 SS EV X containing the SARS spike EcoRV XhoI fragment of phCMV S WT by the homologous frag ment from mouse hepatitis virus MHV spike vector pTUGM S 43 resulting in shuttle vector pSP72 SMHV TMDCyt EV X The MHV sequence was introduced into vector phCMV SWT by exchanging EcoRV XhoI fragments with pSP72 SMHV TMDCyt EV X Synthesis of SARS CoV pseudotyped MLV particles SARSpp SARS spike murine leukemia virus MLV retrovirus particles were produced as described for HCVpp 2 Briefly 293T cells were transfected using a CaCl 2 transfection kit Clontech with a set of retrovirus Gag and Pol expression constructs a green fluorescent protein GFP reporter plasmid and the SARS CoV spike chimeras to be expressed Supernatants were harvested 2 days after transfection and used to transduce VeroE6R cells The percentage of GFP positive cells was deter mined by fluorescence activated cell sorter FACS analysis 4 days after trans duction A C type reverse transcriptase activity kit Innovagen Sweden was used to correct for the amount of retrovirus particles per ml of supernatant between transfections FACS analysis Transduced VeroE6R cells M6 were washed with PBS and harvested using trypsin Cell were diluted in DMEM plus 10 FCS and pelleted for 5 min at 250 H11003 g Cell pellets were washed in PBS and repelleted for 5 min at 250 H11003g Cells were then resuspended in a final volume of 2 0 ml PBS The percentage of GFP positive cells was determined on a FACSCalibur Becton Dickinson MLV SARS spike pseudoparticle neutralization assay A total of 1 H11003 10 4 to 2 H11003 10 4 cells were incubated with 50 fold dilutions of human SARS CoV sera a kind gift of M Niedrig Robert Koch Institute for 45 min at room temper ature prior to infection of VeroE6R cells Subsequently infection was performed as described above Transduction of cells with SARSpp and titer determination Retrovirus SARSpp supernatants were used to transduce target cells Briefly 2 H11003 10 5 cells were seeded 1 day prior to transduction in M6 wells Equal amounts of SARSpp as determined by a reverse transcriptase enzyme linked immunosorbent assay were used to transduce cells in a final volume of 600 H9262l in DMEM containing 4 H9262g ml Polybrene Medium containing SARSpp was replenished after overnight incubation with normal growth medium Cells were harvested 3 to 4 days after transduction and the percentage of GFP positive cells determined by FACS analysis Cell cell fusion assay One pool of 293T cells was transfected with pFLACE2 T7rLuc and another pool was transfected with phCMV S WT or an S chimera and pBp9 CMVT7 using Lipofectamine 2000 Invitrogen using the manufactur er s protocol After 17 to 20 h of incubation at 37 C both pools of cells were trypsinized and mixed in equal amounts After another 24 h incubation at 37 C cells were lysed according to the manual of the Renilla luciferase assay system Promega Luciferase activity was measured using a luminometer TD H1100220 20 Turner Designs On the remainder of the cell lysate a Bradford assay was performed to measure the protein concentration Relative Renilla luciferase activity was calculated as the measured value divided by the protein concentra tion minus the measured value of the control no S divided by the protein concentration Determination of the oligomeric state of spike present on SARSpp 35 S labeled SARSpp retrovirus supernatants were purified with a 20 sucrose cushion SW41 rotor 2 h 25 krpm Pellets containing SARSpp were resuspended in PBS Prior to immunoprecipitation 1 sodium dodecyl sulfate SDS was added to the samples to solubilize the SARSpp Immunoprecipitations were performed as previously described using an anti SARS CoV polyclonal antiserum Immu noprecipitates were resuspended in Laemmli loading buffer 19 without dithio threitol and kept at room temperature or incubated 5 min at 80 C prior to loading of the samples on a 4 polyacrylamide gel RESULTS Expression of SARS CoV Frankfurt S protein and chime ras The SARS CoV strain Frankfurt S protein encoding sequence was cloned into phCMV yielding phCMV SWT In addition several chimeras were constructed to investigate the role of the TMD and the cytoplasmic domain of S in mem brane fusion activity and infectivity In chimera SVSV Cyt the cytoplasmic tail of SARS CoV S was replaced by its vesicular stomatitis virus G protein VSV G counterpart In SVSV TMDCyt the transmembrane and cytoplasmic domains of SARS CoV S were replaced by the VSV G transmembrane and cytoplasmic domains In SMHV TMDCyt the transmembrane and cytoplasmic domains of SARS CoV S were replaced by the MHV A59 S transmembrane and cytoplasmic domains see Fig 1c First expression and maturation of wild type wt S and the S chimeras was studied After transfection of VeroE6R cells with the proper plasmids pulse chase labeling was carried out Cell lysates were subjected to immunoprecipitation with an S specific antibody and subsequent EndoH digestion to check the maturation At the start of the chase Fig 2a lanes 0 the majority of wt S and S chimeras was EndoH sensitive bands marked S Sens indicating that most of the S proteins had not passed the endoplasmic reticulum However a small portion of all S variants already had become EndoH resistant bands marked S Res during the 2 h pulse indicating that a fraction of S and the chimeras already was transported to the Golgi com plex or further downstream the exocytosis route compare lanes H11002 and H11001 EndoH After a 7 h chase the majority of S and the chimeras had become EndoH resistant In summary the expression and maturation of the S chimeras displayed the same kinetics as wt S protein As a negative control VSV G was expressed from the same plasmid resulting in only back ground bands in the gel when S specific antibodies were used Transport