【病毒外文文獻(xiàn)】2007 Type IVB Pilus Operon Promoter Controlling Expression of the Severe Acute Respiratory Syndrome-Associated Coronavir

《【病毒外文文獻(xiàn)】2007 Type IVB Pilus Operon Promoter Controlling Expression of the Severe Acute Respiratory Syndrome-Associated Coronavir》由會(huì)員分享，可在線閱讀，更多相關(guān)《【病毒外文文獻(xiàn)】2007 Type IVB Pilus Operon Promoter Controlling Expression of the Severe Acute Respiratory Syndrome-Associated Coronavir（8頁珍藏版）》請?jiān)谘b配圖網(wǎng)上搜索。

CLINICAL AND VACCINE IMMUNOLOGY Aug 2007 p 990 997 Vol 14 No 8 1556 6811 07 08 00H110010 doi 10 1128 CVI 00076 07 Copyright 2007 American Society for Microbiology All Rights Reserved Type IVB Pilus Operon Promoter Controlling Expression of the Severe Acute Respiratory Syndrome Associated Coronavirus Nucleocapsid Gene in Salmonella enterica Serovar Typhi Elicits Full Immune Response by Intranasal Vaccination H17188 Fengling Luo 1 Yong Feng 1 2 Min Liu 1 Pingfei Li 1 Qin Pan 1 Victor Tunje Jeza 1 Bing Xia 3 Jianguo Wu 2 and Xiao Lian Zhang 1 Department of Immunology Hubei Province Key Laboratory of Allergy and Immune Related Diseases The State Key Laboratory of Virology Wuhan University School of Medicine Wuhan 430071 People s Republic of China 1 The State Key Laboratory of Virology College of Life Sciences Wuhan University Wuhan 430072 People s Republic of China 2 and Zhongnan Hospital Wuhan University Wuhan 430071 People s Republic of China 3 Received 10 February 2007 Returned for modification 6 March 2007 Accepted 31 May 2007 Attenuated Salmonella enterica serovar Typhi strains have been considered to be attractive as potential live oral delivery vector vaccines because of their ability to elicit the full array of immune responses in humans In this study we constructed an attenuated S enterica serovar Typhi strain stably expressing conserved nucleo capsid N protein of severe acute respiratory syndrome associated coronavirus SARS CoV by integrating the N gene into the pilV gene which was under the control of the type IVB pilus operon promoter in S enterica serovar Typhi BALB c mice were immunized with this recombinant strain through different routes intrana sally orogastrically intraperitoneally and intravenously Results showed that the intranasal route caused the highest production of specific immunoglobulin G IgG IgG2a and secretory IgA where IgG2a was imprinted as a Th1 cell bias Moreover this recombinant live vaccine induced significantly high levels of specific cytotoxic T lymphocyte activities and increased gamma interferon producing T cells compared with the parental strain Our work provides insights into how the type IVB pilus operon promoter controlling SARS CoV N gene expression in Salmonella might be attractive for a live vector vaccine against SRAS CoV infection for it could induce mucosal humoral and cellular immune responses Our work also indicates that the type IVB pilus operon promoter controlling foreign gene expression in Salmonella can elicit full immune responses by intranasal vaccination Severe acute respiratory syndrome associated coronavirus SARS CoV is a new emerging virus and has a high mortality rate along with a huge economic impact worldwide It contains five major open reading frames encoding the replicase polyprotein the spike S protein the envelope E protein the membrane glycoprotein M and the nucleocapsid N protein N protein of SARS CoV is a 46 kDa conserved pro tein that participates in the replication and transcription of the virus and interferes with the cell cycle of host cells 36 Amino acid sequence homology between SARS CoV and other CoVs is low and this is a possible cause for the difference in patho genesis 25 It was reported that more than 94 of SARS patients were positive for N protein specific antibodies that appeared at early stages of infection 41 Other studies showed that the highest immune responses were generated by DNA vaccination with the N gene against SARS CoV in mice among constructs encoding N M and E proteins 18 Therefore the N protein was chosen as the target antigen in this study Currently no vaccine is licensed for human SARS CoV al though effective vaccines have been developed for other ani mal CoVs 33 Recently several vaccine strategies have been examined for prevention against SARS infection They include inactivated viruses DNA vaccine and recombinant viral vec tors based on adenoviruses baculoviruses and parainfluenza viruses 2 3 13 35 In addition the surface displayed SARS CoV spike protein on Lactobacillus casei has been reported to induce neutralizing antibodies in mice 22 23 Studies of animal CoV vaccines have demonstrated that both systemic and cell mediated immune responses are important in prevent ing the viral infections 17 DNA vaccines targeting the N protein of SARS CoV generated strong N specific humoral and cellular immunity and reduced the titers of challenging vaccinia virus expressing the N protein of the SARS virus 20 SARS CoV N protein and S protein could induce a long per sistence of memory T cell response in humans 31 42 These pieces of evidence indicate that both humoral and cellular immune responses were vital to defense against acute SARS infection 34 The initial SARS CoV infection occurs primarily in the mu cosal epithelial cells in the respiratory tract There is evidence that mucosal immunity is important in the rapid immune re Corresponding author Mailing address for X L Zhang Depart ment of Immunology Wuhan University School of Medicine 165 Donghu Road Wuhan 430071 People s Republic of China Phone 86 27 87331183 Fax 86 27 87336380 E mail ZhangXL65 whu edu cn Mailing address for J Wu The State Key Laboratory of Virology College of Life Sciences Wuhan University Wuhan 430072 People s Republic of China Phone 86 27 68754979 Fax 86 27 68754592 E mail wu9988 F L and Y F contributed equally to this work H17188 Published ahead of print on 27 June 2007 990 on March 14 2015 by PENN STATE UNIV http cvi asm org Downloaded from sponse to mucosal infections 42 Thus in order to develop an effective vaccine for SARS CoV a good SARS vaccine candi date should elicit both mucosal and systemic immunities Attenuated Salmonella strains have been supposed as attrac tive potential live oral delivery vector vaccines because of their ability to elicit a full array of immune responses in humans 1 8 10 21 24 27 Previously we demonstrated that a Salmo nella enterica serovar Typhi pilS Km r mutant strain signifi cantly attenuated the adhesion and invasion to human intesti nal or monocytic cells compared with those of the wild type strain 28 The type IVB pil operon in S enterica serovar Typhi contains 11 genes pilLMNOPQRSTUV of which pilS encodes the main structural protein and pilV codes for pilus tip adhesion of the type IVB pili These genes form a transcrip tional unit under the control of one pil promoter as evidenced by the absence of independent promoter In this study we sought to obtain an effective Salmonella based viral vaccine candidate with both mucosal and systemic immunities We constructed an S enterica serovar Typhi pilS Km r pilV N H11001 mutant strain by integrating the N gene with the pilV gene under the control of pil operon promoter as the first step towards constructing a live oral Salmonella SARS CoV vac cine and analyzed its specific immune responses in mice with different immunization routes MATERIALS AND METHODS Strains and plasmids The attenuated S enterica serovar Typhi strain Ty2 cys try galE H1 via Rif r pilS Kan r 15 44 was the source for the vaccine strain in this study The eukaryotic expression vector pCMV Tag2B N expressing full length N gene of a SARS CoV strain WHU was described previously 46 Construction of the S enterica serovar Typhi pilS Km r pilV N H11545 recombinant vaccine stably expressing N protein of SARS CoV The most important approach used in the construction of recombinant vaccine is homologous recombination Plasmid pUST100 containing the ApaI EcoRV digestive site fragment with pilV and rci genes 45 was cleaved with BamHI which generated a small fragment and a large fragment after which the large fragment was religated to generate a new plasmid named pUST110 The N gene 1 2 kb of SARS CoV was obtained by digestion of pCMV Tag2B N with BamHI and EcoRI and then inserted into the vector pUST110 digested with BglII and EcoRI to create a recombinant plasmid pUST110 N Plasmid pUST110 N was transferred into the S enterica serovar Typhi pilS Km r strain via the S enterica serovar Typhimurium modifying strain J357 r H11002 m H11001 44 with Ap r and Km r selection Individual clones were then grown in 5 ml LB medium without antibiotic selection at 42 C for periods of ca 24 h before transfer of a 0 1 ml aliquot into 5 ml fresh medium After three or four transfers aliquots were plated onto LB medium containing kanamycin and the resulting colonies that had lost the transformed plasmids were checked for ampicillin sensitivity The S enterica serovar Typhi pilS Km r pilV N H11001 recombi nant vaccine in which the N gene was inserted into the S enterica serovar Typhi genome was screened from large numbers of colonies and examined by PCR amplification using primers adjacent to or inside the inserted fragment as well as by Western blot analysis PCR was used to identify the N gene in the S enterica serovar Typhi pilS Km r pilV N H11001 strain The primers outside the recombinant sequences used for ampli fication were 5H11032 CGATGATAGTCCGGAATCAGC 3H11032 and 5H11032 ATCCGGACG ACCATTGACCTG 3H11032 Primers with insert sequences used for amplification were 5H11032 ATGTCTGATAATGGACC 3H11032 and 5H11032 TGCCTGAGTTGAATCAG 3H11032 The expression of N protein in the S enterica serovar Typhi pilS Km r pilV N H11001 strain was determined by Western blot analysis Immunization process optimization Seven to 8 week old female BALB c mice were prepared for immunization Four groups six mice per group of mice were immunized with the recombinant strain or the parental bacterium strain i intransally i n by dispensing 10 H9262l of vaccine suspension containing 10 9 CFU directly into the mouse nasal cavity ii orogastrically o g by placing 100 H9262lof vaccine suspension containing 10 9 CFU into the lower esophagus using a gavage needle iii intraperitoneally i p and iv intravenously i v by injecting 100 H9262l of vaccine suspension containing 10 7 CFU into the abdominal cavity and vena caudalis respectively on days 0 and 14 Mice were euthanized at day 14 after the last immunization Production of serum immunoglobulin G IgG against N protein was measured by enzyme linked immunosorbent assay ELISA Purification of recombinant N protein and antibody production The N gene of SARS CoV was generated by digestion of pCMV Tag2B N 46 with BamHI and EcoRI and cloned into the BamHI and EcoRI sites of prokaryotic vector pGEX KG to yield plasmid pGEX N Plasmid pGEX N was transformed into E coli BL21 DE3 pLysS The glutathione S transferase GST N fusion protein was overexpressed in E coli after the induction of isopropyl H9252 D thiogalactopy ranoside IPTG The expressed protein was purified by glutathione Sepharose 4B Amersham Biosciences Anti N antibody was prepared from immunized rabbit sera with the recombinant GST N protein Measurement of antibody levels by ELISA Anti N antibodies were detected 2 weeks after the final immunization The levels of antibodies against N protein were determined by ELISA Briefly 96 well plates were coated with 100 H9262lofthe recombinant N protein 10 H9262g ml expressed and purified from E coli BL21 in carbonate buffer pH 9 6 for3hat37 C and blocked overnight with 1 bovine serum albumin at 4 C After incubation the plates were washed with phosphate buffered saline PBS containing 0 05 Tween 20 PBST Sera were subjected for titer determination in twofold serial dilutions Antibodies bound to the immobilized antigens were detected using horseradish peroxidase labeled anti mouse immunoglobulin G IgG IgG2a Southern Biotech diluted at a ratio of 1 1 500 in PBST and substrate solution containing o phenylenediamine 1 mg ml and H 2 O 2 0 03 in 0 1 M citrate phosphate buffer Test and control sera were run in triplicate Detection of anti N S IgA antibody by ELISA For detection of anti N secre tory IgA S IgA briefly flat bottomed microtiter plates were coated with the recombinant N protein expressed and purified from E coli BL21 and blocked with 1 bovine serum albumin The supernatant extracted from 100 H9262gof original fecal pellets of each mouse mixed with 100 H9262l of PBS was subjected to titer determination in twofold serial dilutions Samples were incubated at 100 H9262l well for1hat37 C Horseradish peroxidase conjugated goat anti mouse IgA antibodies Southern Biotech were added at a 1 5 000 dilution in PBST and incubated at 37 C for 1 h Experimental and control samples were run in tripli cate Stable transfection A total of 1 H11003 10 6 CT26 H 2 d murine colon tumor cells 39 were placed into a 60 mm diameter plate 24 h before transfection Each 60 mm diameter plate of cells was transfected with 8 H9262g of plasmid pCMV Tag2B N by Lipofectamine 2000 Invitrogen For stable transfections G418 was added to the cell culture medium at a final concentration of 0 6 mg ml after 48 h posttransfection Cell culture medium was changed every 2 days After 4 weeks of selection N expressing CT26 cells were obtained Cells from wells containing single clones were selected for further analysis and individual transfected clones were tested for expression of N protein by Western blot analysis Specific CTL activity Seven to 8 week old female BALB c mice were immu nized i n with 10 9 CFU 10 H9262l of the recombinant strain or the parental bacterium strain on days 0 and 14 respectively Mice were euthanized at day 28 Spleno cytes from mice were resuspended in complete RPMI 1640 with 10 fetal bovine serum and analyzed for cytotoxic T lymphocyte CTL activity Twofold serial dilutions of mice splenocytes as expanded effector cells 6 25 H11003 10 3 to 2 H11003 10 5 cells well were stimulated by recombinant N protein 5 H9262g ml expressed and purified from E coli BL21 in vitro and incubated with major histocompatibility complex MHC matched CT26 H 2 d which stably expressed N protein as target cells 2 H11003 10 4 cells wells for4hat37 C in the presence of 5 CO 2 Cultures were centrifuged at 1 000 rpm for 5 min 50 H9262l of supernatants per well was then transferred to enzymatic assay plates and lysis was determined by measuring released lactate dehydrogenase LDH by using the Cytotoxic 96 assay kit Promega Corp Madison WI The absorbance values from the su pernatants were recorded at 490 nm on an ELISA microplate reader The data are means H11006 standard deviation SD of five different wells The percentage of cytotoxicity was calculated as experimental H11002 effector spontaneous target spontaneous target maximum target spontaneous H11003 100 where spontane ous release is the count released by target cells in the absence of effecter cells and maximal release is the number of counts released in the presence of lysis solu tion ELISPOT assay For the enzyme linked immunospot ELISPOT assay 96 well filtration plates were coated overnight at 4 C with 50 H9262l 10 H9262g ml of anti mouse gamma interferon IFN H9253 or interleukin 4 IL 4 in sterile PBS The plates were blocked for2hat37 C with RPMI 1640 containing 10 fetal calf serum and 1 bovine serum albumin and were washed three times with sterile PBS Various dilutions of splenocytes from immunized or control mice in 200 H9262l of complete medium were placed in each well and were cultured for 18 h in RPMI 1640 alone negative control or with 5 H9262g per ml recombinant N protein expressed and purified from E coli BL21 or 8 H9262g per ml of concanavalin A VOL 14 2007 SALMONELLA BASED SARS CoV NUCLEOCAPSID VACCINE 991 on March 14 2015 by PENN STATE UNIV http cvi asm org Downloaded from positive control in triplicate wells incubated at 37 C for 24 h Plates were washed with PBS containing 0 025 Tween 20 and were overlaid with 50 H9262l 5 H9262g ml of biotinylated anti mouse IFN H9253 or IL 4 The plates were washed six times with PBS containing 0 025 Tween 20 and were treated with 1 25 H9262gof avidin conjugated alkaline phosphatase Sigma per ml for2hatroom temper ature After a final wash with PBS IFN H9253 or IL 4 spot forming cells were detected by the addition of 5 bromo 4 chloro 3 indolylphosphate BCIP ni troblue tetrazolium solution Sigma and were counted with a stereomicroscope In vivo expansion of CTL effectors in tumor protection model Seven to 8 week old female BALB c mice were immunized i n with 10 H9262l of vaccine suspension containing 10 9 CFU on days 0 and 14 as primary and booster immu nizations At day 14 after the last immunization mice were given subcutaneous injections into the right flank of CT26 target cells which stably express N protein The tumor sizes were measured with calipers every 3 days Tumor volumes were calculated according to the formula volume H11005 width 2 H11003 length H11003 0 52 The data are presented as means H11006 standard errors SE Statistical analysis One way analysis of variance ANOVA and Student s t tests were used for comparison of antibody titers cytotoxicity levels tumor growth and IFN H9253 or IL 4 production by ELISPOT among different groups All tests were performed using SPSS software Values of P H11021 0 05 are considered significant RESULTS Construction of S enterica serovar Typhi pilS Km r pilV N H11545 recombinant strain The recombinant S enterica serovar Typhi pilS Km r pilV N H11001 strain carrying the N gene of SARS CoV was constructed according to the procedures described in Ma terials and Methods and shown in Fig 1A The vaccine strain was confirmed by PCR amplification using the primers outside recombinant sequences in which the N gene was inserted into the pilV gene Fig 1B The size of the PCR product was 1 500 bp from the S enterica serovar Typhi pilS Km r pilV N H11001 re combinant vaccine strain Fig 1B while the PCR product from the S enterica serovar Typhi pilS Km r parental strain was 300 bp Fig 1B PCR using the primers with insert sequences Fig 1C also indicated that the N gene 1 200 bp was inserted into the pilV gene of the genomic DNA in the S enterica serovar Typhi pilS Km r pilV N H11001 recombinant strain We further examined the N protein expression in the S enterica serovar Typhi pilS Km r pilV N H11001 recombinant strain by sodium dodecyl sulfate polyacrylamide gel electrophoresis and Western blot analysis As shown in Fig 1D a protein band of approximately 45 kDa corresponding to the molecular mass of N protein in the cell lysates of the S enterica serovar Typhi pilS Km r pilV N H11001 strain Fig 1D lane 2 was identified but not detected in the cell lysates of the S enterica serovar Typhi pilS Km r parental strain Fig 1D lane 1 The results dem onstrated that the N protein of SARS CoV was expressed in the newly constructed S enterica serovar Typhi pilS Km r pilV N H11001 recombinant strain We have demonstrated the sta bility of insertion and expression of vaccine strain after several in vitro passages S enterica serovar Typhi pilS Km r pilV N H11545 vaccine strain elicited predominant IgG2a subclass antibody responses Se rum IgG responses against N protein were determined in the BALB c mice immunized with the S enterica serovar Typhi pilS Km r pilV N H11001 recombinant vaccine strain through differ ent immunization routes including i n o g i p and i v Re sults from ELISA analysis showed that the i n immunization route caused the highest levels of anti N protein specific IgG and IgG2a Fig 2A and B i n versus o g i p and i v P H11021 0 05 In addition both i n and o g immunization routes in duced the highest levels of specific S IgA among all routes FIG 1 Construction and analysis of the S enterica serovar typhi pilS Km r pilV N H11001 recombinant strain with chromosomal integration of the N gene A Diagram of the construction of the recombinant strain B Analysis of the recombinant strain by PCR amplification using primers outside recombinant sequences Lane 1 S enterica serovar Typhi pilS Km r parental strain lane 2 plasmid pUST110 N lane 3 S enterica serovar Typhi pilS Km r pilV N H11001 recombinant strain lane 4 DNA marker C Analysis of recombinant strain by PCR amplification using primers with insert sequences Lane 1 DNA marker lane 2 S enterica serovar Typhi pilS Km r pilV N H11001